Translation of Genes

Now that we've got transcription under our belts, we can now look at translation.  Translation is where the information that was stored in genes (DNA) is used to create a protein.  Note that the DNA information had to be copied (transcribed) into a new molecule: RNA.  It's very common for students to be unclear about what processes occur during transcription and which ones are translation.

When you're talking about promoters and terminators, enhancers, silencers, and RNA polymerase, you're talking about transcription.  In eukaryotes, RNA splicing, mG capping, and the poly-A tail are all involved in modifications of the transcript (RNA strand).  These events occur BEFORE translation.

Note that only when we're dealing with translation do we start to worry about start codon and stop codons.  Most people have dealt with codons and anticodons in their introductory biology classes, but in my lecture below I look them over again quickly.  Note that I'm adding a little more complexity to these introductory concepts:  I want everyone to know that there's special parts of mRNA - the 5'UTR and the 3'UTR (untranslated regions).  The borders of these are defined by the start and stop codons.

In translation, there's also a set of steps to getting the ribosome to load unto the mRNA.  The ribosome is made of rRNA and protein.  The small subunit in prokaryotes has a piece of rRNA that's complementary to the 5'UTR upstream of the start codon:  the Shine-Dalgarno box.  Eukaryotes have something similar (the Kozak sequence, but which has the start codon embedded within the consensus sequence).  After the small subunit has bound, the first tRNA with its amino acid (methionine in eukaryotes, formylmethionine in prokaryotes) will bind to the start codon, then the large subunit attaches.

Prokaryotes also transcribe and translate their genes simultaneously.  Without a nuclear envelope to partition the RNA polymerase in one compartment (the nucleus) and the ribosomes in another (the cytoplasm) we can see transcription of mRNA that occurs even as it's being manufactured!  Eukaryotes have spacial separation, which may be why they are able to modify their mRNA so extensively before translation.

So, without more buildup, here are the video lectures for "translation"!

Part 1:  Structure of the ribosome

Part 2:  Using the Code

Part 3:  Cracking the Code

Part 4:  Posttranslational Modification and Shipping

---

The "Find the Intron" Game!

Here's a chance for you to try your hand at gene expression.  In this exercise, you're given a piece of DNA and you're told that it encodes an mRNA that has a single intron.  You need to transcribe and translate it, and you also need to use protein information to determine where the intron is.

You can access this question in a Word document online.

---

Find the intron:

You’ve cloned and sequenced a piece of DNA and you know that it contains a gene for the protein you’ve been working to characterize.  The protein contains the amino acid sequence:

leu-pro-trp-ala-gly

The sequenced DNA reads as:

5’GAGCATCCCAGAGGAGGAGATGACACTCCCATGTCCACATGATTACGCAAGGGGCCGGTGGGTAATCGCATACGATTACC3’

3’CTCGTAGGGTCTCCTCCTCTACTGTGAGGGTACAGGTGTACTAATGCGTTCCCCGGCCACCCATTAGCGTATGCTAATGG5’

Write out the full pre-mRNA, including identifying the ends.  Assume that your sequenced DNA would have had the promoter to the left and that the first nucleotide is at the -3 position.  Circle the intron in your mRNA.  Write out the full polypeptide, and label its ends as well.

---

Try the question yourself before accessing the YouTube solution below:

(You can get a larger image by clicking on the YouTube logo in the bottom-right hand corner of the video above).


If you want to try out a dynamic game that creates a new question each time you run it, go to http://www2.mtroyal.ca/~tnickle/2101/cgi-shl/sampleFindIntron.cgi