Showing posts with label problem set. Show all posts
Showing posts with label problem set. Show all posts

Wednesday, 9 November 2011

The "Find the Intron" Game!

Here's a chance for you to try your hand at gene expression.  In this exercise, you're given a piece of DNA and you're told that it encodes an mRNA that has a single intron.  You need to transcribe and translate it, and you also need to use protein information to determine where the intron is.

You can access this question in a Word document online.



Find the intron:
You’ve cloned and sequenced a piece of DNA and you know that it contains a gene for the protein you’ve been working to characterize.  The protein contains the amino acid sequence:
leu-pro-trp-ala-gly
The sequenced DNA reads as:
5’GAGCATCCCAGAGGAGGAGATGACACTCCCATGTCCACATGATTACGCAAGGGGCCGGTGGGTAATCGCATACGATTACC3’
3’CTCGTAGGGTCTCCTCCTCTACTGTGAGGGTACAGGTGTACTAATGCGTTCCCCGGCCACCCATTAGCGTATGCTAATGG5’

Write out the full pre-mRNA, including identifying the ends.  Assume that your sequenced DNA would have had the promoter to the left and that the first nucleotide is at the -3 position.  Circle the intron in your mRNA.  Write out the full polypeptide, and label its ends as well.

Try the question yourself before accessing the YouTube solution below:


(You can get a larger image by clicking on the YouTube logo in the bottom-right hand corner of the video above).


If you want to try out a dynamic game that creates a new question each time you run it, go to http://www2.mtroyal.ca/~tnickle/2101/cgi-shl/sampleFindIntron.cgi